anti map1lc3b lc3b cell signaling technology  (Cell Signaling Technology Inc)

Journal: Scientific reports

Article Title: Withaferin a modulation of microglia autophagy mitigates neuroinflammation and enhances cognitive function in POCD.

doi: 10.1038/s41598-024-75284-6

Figure Lengend Snippet: Fig. 5. WA promoted microglia autophagy and accelerated the degradation of LDs. Microglia were pre- treated with MG132 (10 µM) or 3-MA (5 mM) for one hour, followed by WA protection for one hour, and subsequently stimulated with LPS for 12 h. (A) BODIPY fluorescence probe was used to label LDs molecules in primary microglia (scale bar = 5 μm). (B) Average fluorescence intensity of labeled LDs was measured. (Four independent replicate experiments were conducted). (C) LDs accumulation was assessed in primary microglia through Oil Red staining (scale bar = 5 μm). (D Average area covered by labeled LDs on cells was determined (Four independent replicate experiments were conducted). (E) Primary microglia were labeled using a dual-fluorescence virus (GFP-RFP-MAP1LC3B) to visualize autophagosomes (scale bar = 5 μm). (F) Immunoblotting was performed to detect SQSTM1 and MAP1LC3B expression levels. Band intensities of SQSTM1 and MAP1LC3B in Western blots were quantified and presented in (G) and (H), respectively (Three independent replicate experiments were performed). *P < 0.05, **P < 0.01, ***P < 0.001 compared with the corresponding group, as determined by the one-way ANOVA .

Article Snippet: For primary antibody incubation, the membrane was subjected to an overnight incubation at 4 °C (MAP1LC3B: Cell Signaling Technology, 2775, 1:1000; SQSTM1: Santa, sc-48402, 1:500; GAPDH antibody: Cell Signaling Technology, 5174, 1:3000).

Techniques: Fluorescence, Labeling, Staining, Virus, Western Blot, Expressing

Journal: Scientific reports

Article Title: Withaferin a modulation of microglia autophagy mitigates neuroinflammation and enhances cognitive function in POCD.

doi: 10.1038/s41598-024-75284-6

Figure Lengend Snippet: Fig. 6. WA improved the autophagy level in mice with POCD. (A) Co-labeling of microglia in the hippocampal region of mice with MAP1LC3B was performed (scale bar = 10–5 μm), analyzed by Imaris software and the quantified data were presented in (B) (N = 3). (C) Co-labeling of microglia in the hippocampal region of mice with SQSTM1 was carried out (scale bar = 40–20 μm)). The relative fluorescence intensity of SQSTM1 was shown in (D), and the number of co-labeled cells was displayed in (E) (N = 3).*P < 0.05, **P < 0.01, ***P < 0.001 compared with the corresponding group, as determined by the one- way ANOVA .

Article Snippet: For primary antibody incubation, the membrane was subjected to an overnight incubation at 4 °C (MAP1LC3B: Cell Signaling Technology, 2775, 1:1000; SQSTM1: Santa, sc-48402, 1:500; GAPDH antibody: Cell Signaling Technology, 5174, 1:3000).

Techniques: Labeling, Software, Fluorescence

Journal: Journal of neuroinflammation

Article Title: Targeting CB2R in astrocytes for Parkinson's disease therapy: unraveling the Foxg1-mediated neuroprotective mechanism through autophagy-mediated NLRP3 degradation.

doi: 10.1186/s12974-023-02989-2

Figure Lengend Snippet: Fig. 8 Knockdown of foxg1 hampers autophagic response in astrocytes and inhibits NLRP3 degradation. A Detection of protein levels for NLRP3, Caspase1, pro-Caspase1, IL-1β, and pro-IL-1β in the midbrain tissue by western blot, with quantification shown in panels B–D (n = 4). E Immunofluorescence staining for GFAP (green) and NLRP3 (red) in midbrain tissue of mice, with quantification shown in panel F–H (n = 4). G Mouse midbrain GFAP (red) and MAP1LC3B (green) immunofluorescence staining, the captured image was processed by imaris software, and the fluorescence statistics are shown in H, I (n = 4). J Autophagosomes (marked by red arrows) observed by transmission electron microscope in mouse midbrain tissue. NS means not significant, *P < 0.05, **P < 0.01, ***P < 0.001 compared with the corresponding group, as determined by the one-way ANOVA

Article Snippet: Antibody name Company Item number Application TH Millipore ab152 IHC:1:1000;WB:1:1000 GFAP Abcam ab7260 WB:1:1000;IF:1:1000 NLRP1 Proteintech 12,256-1-AP WB:1:1000 NLRP2 Proteintech 15,182–1-AP WB:1:1000 NLRP3 AdipoGen AG20B-0014-C100 WB:1:1000;IF:1:500 Antibody name Company Item number Application NLRC4 Abcam ab201792 WB:1:1000 GAPDH SantaCruz sc-32233 WB:1:3000 Caspase-1 AdipoGen AG-20B-0042 WB:1:1000 IL1β R&D AF-401-NA WB:1:1000 MAP1LC3B Cell Signaling Technology 2775 WB:1:1000;IF:1:500 Foxg1 Invitrogen PA5-26,794 WB:1:400;;IF:1:200 GFAP Millipore MAB360 IF:1:1000

Techniques: Knockdown, Western Blot, Immunofluorescence, Staining, Software, Fluorescence, Transmission Assay, Microscopy

Journal: Journal of neuroinflammation

Article Title: Targeting CB2R in astrocytes for Parkinson's disease therapy: unraveling the Foxg1-mediated neuroprotective mechanism through autophagy-mediated NLRP3 degradation.

doi: 10.1186/s12974-023-02989-2

Figure Lengend Snippet: Fig. 9 Targeting CB2R in astrocytes for Parkinson’s disease therapy: unraveling the foxg1-mediated neuroprotective mechanism through autophagy-mediated NLRP3 degradation. activation of CB2R reduced the binding of foxg1 to the promoter region of MAP1LC3B, thereby promoting the transcription of MAP1LC3B and increasing the autophagic level in astrocytes. This led to an enhanced autophagic degradation of NLRP3 and a reduction in the release of caspase-1 and IL-1β. As a result, neurodegeneration was alleviated in PD mice. These findings suggest that CB2R activation plays a crucial role in regulating autophagy and may serve as a potential therapeutic target for neurodegenerative disorders

Article Snippet: Antibody name Company Item number Application TH Millipore ab152 IHC:1:1000;WB:1:1000 GFAP Abcam ab7260 WB:1:1000;IF:1:1000 NLRP1 Proteintech 12,256-1-AP WB:1:1000 NLRP2 Proteintech 15,182–1-AP WB:1:1000 NLRP3 AdipoGen AG20B-0014-C100 WB:1:1000;IF:1:500 Antibody name Company Item number Application NLRC4 Abcam ab201792 WB:1:1000 GAPDH SantaCruz sc-32233 WB:1:3000 Caspase-1 AdipoGen AG-20B-0042 WB:1:1000 IL1β R&D AF-401-NA WB:1:1000 MAP1LC3B Cell Signaling Technology 2775 WB:1:1000;IF:1:500 Foxg1 Invitrogen PA5-26,794 WB:1:400;;IF:1:200 GFAP Millipore MAB360 IF:1:1000

Techniques: Activation Assay, Binding Assay

Journal: Autophagy

Article Title: Chloroquine treatment induces secretion of autophagy-related proteins and inclusion of Atg8-family proteins in distinct extracellular vesicle populations

doi: 10.1080/15548627.2022.2039535

Figure Lengend Snippet: Key reagents.

Article Snippet: Name Source Identifier Antibodies ATG16L1 MBL M150-3 ATG4B Sigma A2981 ATP5F1A/ATP5α abcam Ab14748 CASP3 Cell Signaling Technology 9662 Cleaved CASP3 Cell Signaling Technology 9664 CASP7 Cell Signaling Technology 9492 CD63 (WB) Thermo Fisher Ts63 CD63 (IF, WB) Santa Cruz Biotechnology sc-MX-49.129.5 CD9 (Mouse) Santa Cruz Biotechnology sc-13,118 CD9 (Rabbit) Cell Signaling Technology 13174S GAPDH Novus Biologicals NB100–56,875 HSP90AA1 Abcam ab13492 ERN1/IRE1a Cell Signaling Technology 3294S LMNA/lamin A/C Cell Signaling Technology 2032 LAMP2 (IF, WB) Hybridoma bank H4B4 SDCBP/syntenin-1 Abcam Ab133267 TAX1BP1 Cell Signaling Technology 5105S TSG101 Sigma T5701 GABARAP (IF, WB) MBL M135–3 GABARAPL2 Abcam Ab126607 NDP52 Abcam 68,588 MAP1LC3A Cell Signaling Technology 4599S MAP1LC3B (LC3B) (WB) Abcam AB48394 MAP1LC3B (LC3B) (IF) Cell Signaling Technology 3868 SQSTM1/p62 Sigma P0067 ULK1 Cell Signaling Technology 8054S ACTB/β-actin Abcam Ab6276 Anti-Mouse IgG, HRP-linked Cell Signaling Technology 7076S Anti-Rabbit IgG, HRP-linked Cell Signaling Technology 7074S Alexa Fluor 488 Goat anti-rabbit IgG Invitrogen A-11034 Alexa Fluor 568 Goat anti-rabbit IgG Invitrogen A-11011 Alexa Fluor 647 Goat anti-rabbit IgG Invitrogen A-21244 Alexa Fluor 488 Goat anti-mouse IgG Invitrogen A-11001 Alexa Fluor 568 Goat anti-mouse IgG Invitrogen A-11004 Alexa Fluor 647 Goat anti-mouse IgG Invitrogen A-21235 Oligonucleotides ATG4B CRISPR gRNA1: TCCTGTCGATGAATGCGTTG Addgene 1000000048 ATG4B CRISPR gRNA2: TCCTCAACGCATTCATCGAC Addgene 1000000048 ATG16L1 CRISPR gRNA1: CTTCCCAAAGCTTAACCCTG Addgene 1000000048 ATG16L1 CRISPR gRNA2: GAATAACCAAATGCAGCGGA Addgene 1000000048 GABARAP CRISPR gRNA1: CCTGGACAAAAAGAAATACC Addgene 1000000048 GABARAP CRISPR gRNA2: GGATCTTCTCGCCCTCAGAG Addgene 1000000048 MAP1LC3B CRISPR gRNA1: TTCAAGCAGCGCCGCACCTT Addgene 1000000048 MAP1LC3B CRISPR gRNA2: GTGAGCTCATCAAGATAATT Addgene 1000000048 ULK1 CRISPR gRNA: AGCCATGCGCACGCTGAGCG Addgene 1000000048 Recombinant DNA pSpCas9(BB)-2A-Puro (PX459) Addgene 48139 pLENTI-hATG16L1β [ 26 ] N/A pLENTI-hATG16L1α [ 26 ] N/A pLENTI-hATG16L1 aa1-249 [ 26 ] N/A psPAX2 Addgene 12260 pCMV-VSV-G Addgene 8454 pCT-CD63-GFP Dr. Cathie Garnis, BCCRI N/A Open in a separate window Note: Addgene 1000000048 and 48,39 were deposited by Feng Zhang; Addgene 12260 was deposited by Didier Trono; Addgene 8454 was deposited by Bob Weinberg.

Techniques: CRISPR, Recombinant

Journal: Autophagy

Article Title: Activation of PPARA-mediated autophagy reduces Alzheimer disease-like pathology and cognitive decline in a murine model

doi: 10.1080/15548627.2019.1596488

Figure Lengend Snippet: Primary antibodies used in this study.

Article Snippet: Primary antibodies Source Catalog no. Western blot Immunofluorescence Immunohistochemistry Rabbit monoclonal anti-MAP1LC3B/LC3B Cell Signaling Technology 3868 1:1000 - - Rabbit monoclonal anti-MAP1LC3B/LC3B Abcam ab64781 - 1:500 - Mouse anti-β-amyloid,17–24(4G8) BioLegend 800701 - 1:500 1:500 Rabbit polyclonal anti-SQSTM1 Elabscience EAP3350 1:1000 - - Rabbit polyclonal anti-LAMP1 Abcam ab24170 1:1000 1:300 - Rabbit monoclonal anti-BECN1 Cell Signaling Technology 3495 1:1000 - - Rabbit monoclonal FKBP5 Cell Signaling Technology 12210 1:1000 - - Mouse monoclonal anti-DLG4 Cell Signaling Technology 36233 1:1000 - - Rabbit polyclonal anti-DLG4 Abcam ab18258 - - 1:200 Rabbit monoclonal anti-GFAP Cell Signaling Technology 12389 1:1000 1:300 - Mouse monoclonal anti-GFAP Millipore MAB360 - 1:300 - Rabbit monoclonal anti-AIF1 Abcam ab178680 1:1000 1:300 - Mouse monoclonal anti-AIF1 Millipore MABN92 - 1:300 - Rabbit polyclonal anti-TFEB Elabscience EAP2314 1:1000 - - Rabbit polyclonal anti-PPARA Elabscience ESAP13084 1:500 - - Mouse monoclonal anti-SYP Millipore MAB5258-50UG 1:10000 - - Mouse monoclonal anti-CD68 Abcam ab201973 1:1000 - - Rabbit monoclonal anti-β-amyloid/Aβ/total Aβ Cell Signaling Technology 8243 1:1000 - - Rabbit monoclonal anti-β-amyloid (1-42 Specific)/Aβ42 Cell Signaling Technology 14974 1:1000 - - Rabbit anti-β-amyloid (1-40 Specific)/Aβ40 Cell Signaling Technology 12990 1:1000 - - Mouse monoclonal anti-GAPDH Proteintech 60004–1-Ig 1:10000 - - Mouse monoclonal anti-ACTB Beijing Zhong Shan-Golden Bridge Biological Technology CO., LTD TA-09 1:10000 - - Open in a separate window Primary antibodies used in this study.

Techniques: Western Blot, Immunofluorescence, Immunohistochemistry